Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08030

HP ID(1) HP08030
Gene ID(2) 254552
Gene Symbol finder NUDT8
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 8
RefSeq NM_181843.1
Length of RefSeq (bp) 834
Chromosome 11q13.2
Reference DDBJ accession
UniGene Hs.433329

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088K12 pGCAP10 CTCTTCCCTCGCCCGATCCCGCGCCCTCAGTGTCCCGGCCGCGCAGGACTTGACATGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl