Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDT8

Gene ID (NCBI) 254552
Gene Symbol NUDT8
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 8
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY090253 IRAL025K13 pOTB7 BC018644 NM_181843

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE099206 M01C048A06 pDONR221 MGC13-F03 BC018644 ENST00000301490
HGE099254 M01C048C06 pDONR221 MGC13-F03 BC018644 ENST00000301490
HGE099302 M01C048E06 pDONR221 MGC13-F03 BC018644 ENST00000301490
HGE099350 M01C048G06 pDONR221 MGC13-F03 BC018644 ENST00000301490
HGE099398 M01C048I06 pDONR221 MGC13-F03 BC018644 ENST00000301490
HGE099446 M01C048K06 pDONR221 MGC13-F03 BC018644 ENST00000301490
HGE099494 M01C048M06 pDONR221 MGC13-F03 BC018644 ENST00000301490
HGE099542 M01C048O06 pDONR221 MGC13-F03 BC018644 ENST00000301490

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR235452 ARiS088K12 pGCAP10 NM_181843.1
CTCTTCCCTCGCCCGATCCCGCGCCCTCAGTGTCCCGGCCGCGCAGGACTTGACATGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl