Prev. |  KEGG KO K18665 > 

RIKEN DNA Bank Human Resource - NUDT8

Gene ID NCBI Gene 254552 |  KEGG hsa:254552
Gene Symbol NUDT8
Protein Name nudix hydrolase 8
Synonyms -
Ortholog resource in our bank

  NUDT8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090253 IRAL025K13 pOTB7 BC018644 NM_181843

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099206 M01C048A06 pDONR221 MGC13-F03 BC018644 ENST00000301490  
HGE099254 M01C048C06 pDONR221 MGC13-F03 BC018644 ENST00000301490  
HGE099302 M01C048E06 pDONR221 MGC13-F03 BC018644 ENST00000301490  
HGE099350 M01C048G06 pDONR221 MGC13-F03 BC018644 ENST00000301490  
HGE099398 M01C048I06 pDONR221 MGC13-F03 BC018644 ENST00000301490  
HGE099446 M01C048K06 pDONR221 MGC13-F03 BC018644 ENST00000301490  
HGE099494 M01C048M06 pDONR221 MGC13-F03 BC018644 ENST00000301490  
HGE099542 M01C048O06 pDONR221 MGC13-F03 BC018644 ENST00000301490  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235452 ARiS088K12 pGCAP10 NM_181843.1  
CTCTTCCCTCGCCCGATCCCGCGCCCTCAGTGTCCCGGCCGCGCAGGACTTGACATGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl