Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08017

HP ID(1) HP08017
Gene ID(2) 5892
Gene Symbol finder RAD51L3
Protein Name RAD51-like 3 (S. cerevisiae)
RefSeq NM_002878.2
Length of RefSeq (bp) 1849
Chromosome 17q11
Reference DDBJ accession
UniGene Hs.631757

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088D22 pGCAP10 GCTCCTCCTCTCTCCTTTCTCCTCCGGCAGCCAGCGCGCCTGTGTCCTCTCTAGGAAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl