Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08006

HP ID(1) HP08006
Gene ID(2) 339229
Gene Symbol finder C17orf90
Protein Name chromosome 17 open reading frame 90
RefSeq NM_001039842.1
Length of RefSeq (bp) 635
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.655241

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS087J24 pGCAP10 GGCGNANGGTGGTCGAGGGAGGCCGGGCGGTAGCCGCCGCGGTCCGTGGCTCGGCAAGTA
RBdS081K06 pGCAP10 GGATGCTGCTGCGGAGGGTGGTCGAGGGAGGCCGGGCGGTAGCCGCCGCGGTCCGTGGCT
RBdS156O24 pGCAP10 GGCGGAGGGTGGTCGAGGGAGGCCGGGCGGTAGCCGCCGCGGTCCGTGGCTCGGCAAGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl