Prev. | 

RIKEN DNA Bank Human Resource - OXLD1

Gene ID NCBI Gene 339229 |  KEGG hsa:339229
Gene Symbol OXLD1
Protein Name oxidoreductase like domain containing 1
Synonyms C17orf90
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY042444 IRAK106B20 pBluescript BC048102 NM_001039842 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235040 ARiS087J24 pGCAP10 NM_001039842.1  
GGCGNANGGTGGTCGAGGGAGGCCGGGCGGTAGCCGCCGCGGTCCGTGGCTCGGCAAGTA
HKR432646 RBdS081K06 pGCAP10 NM_001039842.1  
GGATGCTGCTGCGGAGGGTGGTCGAGGGAGGCCGGGCGGTAGCCGCCGCGGTCCGTGGCT
HKR462760 RBdS156O24 pGCAP10 NM_001039842.1  
GGCGGAGGGTGGTCGAGGGAGGCCGGGCGGTAGCCGCCGCGGTCCGTGGCTCGGCAAGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl