Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07990

HP ID(1) HP07990
Gene ID(2) 129401
Gene Symbol finder NUP35
Protein Name nucleoporin 35kDa
RefSeq NM_138285.3
Length of RefSeq (bp) 1649
Chromosome 2q32.1
Reference DDBJ accession
UniGene Hs.180591

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085O23 pGCAP10 GGAAAATTAATTGGGAAGGTACTGGTTTTAAGTGTAGTTGCCGACGCAATGGCAGCCTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl