Prev. |  KEGG KO K14313 > 

RIKEN DNA Bank Human Resource - NUP35

Gene ID NCBI Gene 129401 |  KEGG hsa:129401
Gene Symbol NUP35
Protein Name nucleoporin 35
Synonyms MP-44|MP44|NP44|NUP53
Ortholog resource in our bank

  NUP35

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027501 IRAK068M13 pCMV-SPORT6 BC035597 NM_138285 Full
HGX037555 IRAK093O19 pCMV-SPORT6 BC047029 NM_138285 Full
HGY099239 IRAL048B15 pDNR-LIB BC061698 NM_138285 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005739 W01A014F19 pENTR-TOPO IRAK093O19 BC047029 NM_138285  
HGE005743 W01A014F23 pENTR-TOPO IRAK093O19 BC047029 NM_138285  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234359 ARiS085O23 pGCAP10 NM_138285.3  
GGAAAATTAATTGGGAAGGTACTGGTTTTAAGTGTAGTTGCCGACGCAATGGCAGCCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl