Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUP35

Gene ID (NCBI) 129401
Gene Symbol NUP35
Protein Name nucleoporin 35kDa
Synonyms MP-44|MP44|NP44|NUP53
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027501 IRAK068M13 pCMV-SPORT6 BC035597 NM_138285 Full
HGX037555 IRAK093O19 pCMV-SPORT6 BC047029 NM_138285 Full
HGY099239 IRAL048B15 pDNR-LIB BC061698 NM_138285 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE005739 W01A014F19 pENTR-TOPO IRAK093O19 BC047029 NM_138285
HGE005743 W01A014F23 pENTR-TOPO IRAK093O19 BC047029 NM_138285

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR234359 ARiS085O23 pGCAP10 NM_138285.3
GGAAAATTAATTGGGAAGGTACTGGTTTTAAGTGTAGTTGCCGACGCAATGGCAGCCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl