Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07978

HP ID(1) HP07978
Gene ID(2) 5910
Gene Symbol finder RAP1GDS1
Protein Name RAP1, GTP-GDP dissociation stimulator 1
RefSeq NM_021159.4
Length of RefSeq (bp) 3767
Chromosome 4q23-q25
Reference DDBJ accession
UniGene Hs.132858

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085K01 pGCAP10 GAGCAGCACCAGCTGCTCCTCCCCGGCGGCCGCCCCCCGCGGGTCCCTCCCTGGCTGCGG
RBd52C10 pGCAP10 CGGCCGGCCGATGCCCTGGCTGCGGGAGAGACGGAGGTAGAGGGAGGACACAGAGCCGCG
RBd61D08 pGCAP10 TGGCGGGTCCCTCCCTGGCTGCGGGAGAGACGGAGGTAGAGGGAGGACACAGAGCCGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl