Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07975

HP ID(1) HP07975
Gene ID(2) 201562
Gene Symbol finder PTPLB
Protein Name protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
RefSeq NM_198402.3
Length of RefSeq (bp) 1187
Chromosome 3q21.1
Reference DDBJ accession
UniGene Hs.705480

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085H17 pGCAP10 GCCTCTCCTCGCGTANTCCGGCCCGAGCCGCTCGCGCTAGGAGAGCGGGCTTCGGGCACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl