Prev. |  KEGG KO K10703 > 

RIKEN DNA Bank Human Resource - HACD2

Gene ID NCBI Gene 201562 |  KEGG hsa:201562
Gene Symbol HACD2
Protein Name 3-hydroxyacyl-CoA dehydratase 2
Synonyms PTPLB
Ortholog resource in our bank

  HACD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010877 IRAK027D05 pCMV-SPORT6 BC016990 NM_198402 Partial/var
HGY053523 IRAK133N11 pBluescript BC060839 NM_198402 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113602 M01C084A02 pDONR221 IMS05-F01 BC060839 NM_198402  
HGE113650 M01C084C02 pDONR221 IMS05-F01 BC060839 NM_198402  
HGE113698 M01C084E02 pDONR221 IMS05-F01 BC060839 NM_198402  
HGE113746 M01C084G02 pDONR221 IMS05-F01 BC060839 NM_198402  
HGE113794 M01C084I02 pDONR221 IMS05-F01 BC060839 NM_198402  
HGE113842 M01C084K02 pDONR221 IMS05-F01 BC060839 NM_198402  
HGE113890 M01C084M02 pDONR221 IMS05-F01 BC060839 NM_198402  
HGE113938 M01C084O02 pDONR221 IMS05-F01 BC060839 NM_198402  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234185 ARiS085H17 pGCAP10 NM_198402.3  
GCCTCTCCTCGCGTANTCCGGCCCGAGCCGCTCGCGCTAGGAGAGCGGGCTTCGGGCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl