Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07965

HP ID(1) HP07965
Gene ID(2) 8493
Gene Symbol finder PPM1D
Protein Name protein phosphatase 1D magnesium-dependent, delta isoform
RefSeq NM_003620.2
Length of RefSeq (bp) 3163
Chromosome 17q23.2
Reference DDBJ accession
UniGene Hs.591184

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085A15 pGCAP10 GAAGCGCAGTGCGCAGGCGCAACTGCCTGGCTCTGCTCGCTCCGGCGCTCCGGCCCAGCT
RBdS187P11 pGCAP10 GGGGCGGTGGGGGGAAGCGCAGTGCGCAGGCGCAACTGCCTGGCTCTGCTCGCTCCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl