Prev. |  KEGG KO K10147 > 

RIKEN DNA Bank Human Resource - PPM1D

Gene ID NCBI Gene 8493 |  KEGG hsa:8493
Gene Symbol PPM1D
Protein Name protein phosphatase, Mg2+/Mn2+ dependent 1D
Synonyms IDDGIP|PP2C-DELTA|WIP1
Ortholog resources KEGG ortholog (KEGG orthology K10147) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010480 IRAK026D08 pCMV-SPORT6 BC016480 NM_003620 Full
HGY019040 IRAK047J24 pBluescriptR BC033893 NM_003620 Full/var
HGY053467 IRAK133L03 pBluescript BC060877 NM_003620 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234015 ARiS085A15 pGCAP10 NM_003620.2  
GAAGCGCAGTGCGCAGGCGCAACTGCCTGGCTCTGCTCGCTCCGGCGCTCCGGCCCAGCT
HKR475171 RBdS187P11 pGCAP10 NM_003620.2  
GGGGCGGTGGGGGGAAGCGCAGTGCGCAGGCGCAACTGCCTGGCTCTGCTCGCTCCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl