Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07962

HP ID(1) HP07962
Gene ID(2) 23093
Gene Symbol finder TTLL5
Protein Name tubulin tyrosine ligase-like family, member 5
RefSeq NM_015072.3
Length of RefSeq (bp) 4692
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.709609

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS055P19 pGCAP10 GGTAGTAACCGGGGAAGCANCCGTCGGCGGCTGCCCTGAGCCTTCCTGGGGAAGGAGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl