Prev. |  KEGG KO K16602 > 

RIKEN DNA Bank Human Resource - TTLL5

Gene ID NCBI Gene 23093 |  KEGG hsa:23093
Gene Symbol TTLL5
Protein Name tubulin tyrosine ligase like 5
Synonyms CORD19|KIAA0998|STAMP
Ortholog resource in our bank

  TTLL5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222379 ARiS055P19 pGCAP10 NM_015072.3  
GGTAGTAACCGGGGAAGCANCCGTCGGCGGCTGCCCTGAGCCTTCCTGGGGAAGGAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl