Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07960

HP ID(1) HP07960
Gene ID(2) 23550
Gene Symbol finder PSD4
Protein Name pleckstrin and Sec7 domain containing 4
RefSeq NM_012455.2
Length of RefSeq (bp) 5039
Chromosome 2q13
Reference DDBJ accession
UniGene Hs.516306

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS055P03 pGCAP10 TGGGCGGAACTGGGAATGTGCACCTGGAGCCCCAGGACTAACTCGGGGAGGCTGGAGGCG
ARiS118A15 pGCAP10 GAGCCGGCGCCTGGGCGCGGGGCCGTGGGGCGCGCGGGCCCGCGGGAGGCCGGAGCAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl