Prev. |  KEGG KO K12494 > 

RIKEN DNA Bank Human Resource - PSD4

Gene ID NCBI Gene 23550 |  KEGG hsa:23550
Gene Symbol PSD4
Protein Name pleckstrin and Sec7 domain containing 4
Synonyms EFA6B|TIC
Ortholog resources KEGG ortholog (KEGG orthology K12494) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005178 IRAK012P18 pCMV-SPORT6 BC035307 NM_012455 Full/var
HGX069696 IRAK174D24 pCMV-SPORT6 BC073151 NM_012455 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222363 ARiS055P03 pGCAP10 NM_012455.2  
TGGGCGGAACTGGGAATGTGCACCTGGAGCCCCAGGACTAACTCGGGGAGGCTGGAGGCG
HKR247215 ARiS118A15 pGCAP10 NM_012455.2  
GAGCCGGCGCCTGGGCGCGGGGCCGTGGGGCGCGCGGGCCCGCGGGAGGCCGGAGCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl