Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PSD4

Gene ID (NCBI) 23550
Gene Symbol PSD4
Protein Name pleckstrin and Sec7 domain containing 4
Synonyms EFA6B|TIC
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005178 IRAK012P18 pCMV-SPORT6 BC035307 NM_012455 Full/var
HGX069696 IRAK174D24 pCMV-SPORT6 BC073151 NM_012455 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222363 ARiS055P03 pGCAP10 NM_012455.2  
TGGGCGGAACTGGGAATGTGCACCTGGAGCCCCAGGACTAACTCGGGGAGGCTGGAGGCG
HKR247215 ARiS118A15 pGCAP10 NM_012455.2  
GAGCCGGCGCCTGGGCGCGGGGCCGTGGGGCGCGCGGGCCCGCGGGAGGCCGGAGCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl