DNA Bank Top |  KEGG KO K12494 > 

RIKEN DNA Bank Human Resource - PSD4

Gene ID NCBI Gene 23550 |  KEGG hsa:23550
Gene Symbol PSD4
Protein Name pleckstrin and Sec7 domain containing 4
Synonyms EFA6B|TIC
Featured content Endocytosis (human)

Link

Ortholog resource in our bank

  PSD4

External database

human PSD4

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20109 EGFP-hEFA6B Expression vector of human EFA6B for mammalian cells, N-teminal EGFP-tag.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005178 IRAK012P18 pCMV-SPORT6 BC035307 NM_012455 Full/var
HGX069696 IRAK174D24 pCMV-SPORT6 BC073151 NM_012455 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222363 ARiS055P03 pGCAP10 NM_012455.2  
TGGGCGGAACTGGGAATGTGCACCTGGAGCCCCAGGACTAACTCGGGGAGGCTGGAGGCG
HKR247215 ARiS118A15 pGCAP10 NM_012455.2  
GAGCCGGCGCCTGGGCGCGGGGCCGTGGGGCGCGCGGGCCCGCGGGAGGCCGGAGCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl