Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07925

HP ID(1) HP07925
Gene ID(2) 57710
Gene Symbol finder KIAA1614
Protein Name KIAA1614
RefSeq NM_020950.1
Length of RefSeq (bp) 4155
Chromosome 1q25.3
Reference DDBJ accession
UniGene Hs.647760

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049A22 pGCAP10 GGCGGCCCGTGGGGCGCTGCGCCGGCCAGACCCACCCGGGGCCCGGGGGCTGCCAGCAGA
RBdS081O07 pGCAP10 GCCCAACCCGGAGCCTGTGCTGAGCCCCAGGCATGAGGAAGCCACGCATCTGCTGCAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl