Prev. | 

RIKEN DNA Bank Human Resource - KIAA1614

Gene ID NCBI Gene 57710 |  KEGG hsa:57710
Gene Symbol KIAA1614
Protein Name KIAA1614
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219622 ARiS049A22 pGCAP10 NM_020950.1  
GGCGGCCCGTGGGGCGCTGCGCCGGCCAGACCCACCCGGGGCCCGGGGGCTGCCAGCAGA
HKR432743 RBdS081O07 pGCAP10 NM_020950.1  
GCCCAACCCGGAGCCTGTGCTGAGCCCCAGGCATGAGGAAGCCACGCATCTGCTGCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl