Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07915

HP ID(1) HP07915
Gene ID(2) 7287
Gene Symbol finder TULP1
Protein Name tubby like protein 1
RefSeq NM_003322.3
Length of RefSeq (bp) 2107
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.485208

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd95E12 pGCAP10 AB593123 GGCTCCTAGACCTGCAGAGAAAGGGGTGCGATAGGCAAAGGCACCATGCCTCTGCGGGAT
RBdS054P11 pGCAP10 GAGAGAAAGGGGTGCGATAGGCAAAGGCACCATGCCTCTGCGGGATGAAACCCTCCGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl