Prev. |  KEGG KO K19600 > 

RIKEN DNA Bank Human Resource - TULP1

Gene ID NCBI Gene 7287 |  KEGG hsa:7287
Gene Symbol TULP1
Protein Name TUB like protein 1
Synonyms LCA15|RP14|TUBL1
Ortholog resource in our bank

  TULP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027744 IRAK069F24 pCMV-SPORT6 BC032714 NM_003322 Full/var
HGX056239 IRAK140J23 pCMV-SPORT6 BC065261 NM_003322 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009657 W01A024C09 pENTR-TOPO IRAK140J23 BC065261 NM_003322  
HGE009663 W01A024C15 pENTR-TOPO IRAK140J23 BC065261 NM_003322  
HGE009667 W01A024C19 pENTR-TOPO IRAK140J23 BC065261 NM_003322  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR398108 RBd95E12 pGCAP10 NM_003322.3  
GGCTCCTAGACCTGCAGAGAAAGGGGTGCGATAGGCAAAGGCACCATGCCTCTGCGGGAT
HKR421971 RBdS054P11 pGCAP10 NM_003322.3  
GAGAGAAAGGGGTGCGATAGGCAAAGGCACCATGCCTCTGCGGGATGAAACCCTCCGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl