Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07906

HP ID(1) HP07906
Gene ID(2) 64710
Gene Symbol finder NUCKS1
Protein Name nuclear casein kinase and cyclin-dependent kinase substrate 1
RefSeq NM_022731.3
Length of RefSeq (bp) 6453
Chromosome 1q32.1
Reference DDBJ accession
UniGene Hs.213061

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd65B02 pGCAP10 GATCCATTTTGAAGAGACGGGGGAGCGGGGGGCTCGTCTGTTCCAGGAGCCCTGAACCAA
RBd76B03 pGCAP10 GATCCATTTTGAAGAGACGGGGGAGCGGGGGGCTCGTCTGTTCCAGGAGCCCTGAACCAA
RBdS132O07 pGCAP10 GGGGCGCATTTTCGGCTGGTTTGATTCATCCATTTTGAAGAGACGGGGGAGCGGGGGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl