Prev. | 

RIKEN DNA Bank Human Resource - NUCKS1

Gene ID NCBI Gene 64710 |  KEGG hsa:64710
Gene Symbol NUCKS1
Protein Name nuclear casein kinase and cyclin dependent kinase substrate 1
Synonyms JC7|NUCKS
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001851 IRAK004K11 pCMV-SPORT6 BC000805 NM_022731

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386026 RBd65B02 pGCAP10 NM_022731.3  
GATCCATTTTGAAGAGACGGGGGAGCGGGGGGCTCGTCTGTTCCAGGAGCCCTGAACCAA
HKR390427 RBd76B03 pGCAP10 NM_022731.3  
GATCCATTTTGAAGAGACGGGGGAGCGGGGGGCTCGTCTGTTCCAGGAGCCCTGAACCAA
HKR453143 RBdS132O07 pGCAP10 NM_022731.3  
GGGGCGCATTTTCGGCTGGTTTGATTCATCCATTTTGAAGAGACGGGGGAGCGGGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl