Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07899

HP ID(1) HP07899
Gene ID(2) 54896
Gene Symbol finder PQLC2
Protein Name PQ loop repeat containing 2
RefSeq NM_001040125.1
Length of RefSeq (bp) 2279
Chromosome 1p36.13
Reference DDBJ accession
UniGene Hs.647620

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191L09 pGCAP10 GAGTGGGTGGTAGCCCCGAGCTGGGACGCTCCTCCCTCCACAATCTCCCCAGGTCTGCAG
RBd43E09 pGCAP10 GGCCTTGACCCAGAAGCTGGGCCCTGGCGGCGGATCTGGACGTGGCGGCCCGCGCCGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl