RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SLC66A1

Gene ID	NCBI Gene 54896 \| KEGG hsa:54896
Gene Symbol	SLC66A1
Protein Name	solute carrier family 66 member 1
Synonyms	LAAT-1\|LAAT1\|PQLC2

Ortholog resource in our bank

  SLC66A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX011090	IRAK027M02	pCMV-SPORT6	BC015324	NM_001040126	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR276673	ARiS191L09	pGCAP10	NM_001040125.1
HKR276673	GAGTGGGTGGTAGCCCCGAGCTGGGACGCTCCTCCCTCCACAATCTCCCCAGGTCTGCAG
HKR377305	RBd43E09	pGCAP10	NM_001040125.1
HKR377305	GGCCTTGACCCAGAAGCTGGGCCCTGGCGGCGGATCTGGACGTGGCGGCCCGCGCCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl