Prev. |  KEGG KO K23678 > 

RIKEN DNA Bank Human Resource - PQLC2

Gene ID NCBI Gene 54896 |  KEGG hsa:54896
Gene Symbol PQLC2
Protein Name PQ loop repeat containing 2
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K23678) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011090 IRAK027M02 pCMV-SPORT6 BC015324 NM_001040126 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276673 ARiS191L09 pGCAP10 NM_001040125.1  
GAGTGGGTGGTAGCCCCGAGCTGGGACGCTCCTCCCTCCACAATCTCCCCAGGTCTGCAG
HKR377305 RBd43E09 pGCAP10 NM_001040125.1  
GGCCTTGACCCAGAAGCTGGGCCCTGGCGGCGGATCTGGACGTGGCGGCCCGCGCCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl