Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07898

HP ID(1) HP07898
Gene ID(2) 253943
Gene Symbol finder YTHDF3
Protein Name YTH domain family, member 3
RefSeq NM_152758.4
Length of RefSeq (bp) 5156
Chromosome 8q12.3
Reference DDBJ accession
UniGene Hs.491861

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd43D12 pGCAP10 TGGTGGACCCGAGAAGCAGAGAGCGAGAGGGGGAAGAGGAGCGTGCAAGCGGAAAAGACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl