Prev. |  KEGG KO K20102 > 

RIKEN DNA Bank Human Resource - YTHDF3

Gene ID NCBI Gene 253943 |  KEGG hsa:253943
Gene Symbol YTHDF3
Protein Name YTH N6-methyladenosine RNA binding protein 3
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K20102) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR377284 RBd43D12 pGCAP10 NM_152758.4 done
TGGTGGACCCGAGAAGCAGAGAGCGAGAGGGGGAAGAGGAGCGTGCAAGCGGAAAAGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.09.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl