Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07897

HP ID(1) HP07897
Gene ID(2) 547
Gene Symbol finder KIF1A
Protein Name kinesin family member 1A
RefSeq NM_004321.4
Length of RefSeq (bp) 8843
Chromosome 2q37.3
Reference DDBJ accession
UniGene Hs.516802

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS014C08 pGCAP10 GACGCGGCGGCGCCGTCACAGCGCAGAGCAGCCGGCGAGCGGCAGCAGCTCCGGGCTCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl