Prev. |  KEGG KO K10392 > 

RIKEN DNA Bank Human Resource - KIF1A

Gene ID NCBI Gene 547 |  KEGG hsa:547
Gene Symbol KIF1A
Protein Name kinesin family member 1A
Synonyms ATSV|C2orf20|HSN2C|MRD9|SPG30|UNC104
Ortholog resources KEGG ortholog (KEGG orthology K10392) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056069 IRAK140C21 pCMV-SPORT6 BC064906 NM_004321 Partial
HGY086261 IRAL015K21 pOTB7 BC021199 NM_004321
HGY090088 IRAL025D16 pOTB7 BC009491 NM_004321 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR405656 RBdS014C08 pGCAP10 NM_004321.4  
GACGCGGCGGCGCCGTCACAGCGCAGAGCAGCCGGCGAGCGGCAGCAGCTCCGGGCTCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl