Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07890

HP ID(1) HP07890
Gene ID(2) 6045
Gene Symbol finder RNF2
Protein Name ring finger protein 2
RefSeq NM_007212.3
Length of RefSeq (bp) 3551
Chromosome 1q25.3
Reference DDBJ accession
UniGene Hs.591490

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd42E12 pGCAP10 GGTGCGGCGGCGCCGGCGTCCGCGGCAGCTGATACCAGAGTCTTGCTCCGGCCGCGGCCA
RBdS007M15 pGCAP10 GGGGGCGGTGGCGCGGGTTCTCCAGGCCAACACGCGGCGGCGCACCCTCCCCTCGCGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl