Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07878

HP ID(1) HP07878
Gene ID(2) 91433
Gene Symbol finder RCCD1
Protein Name RCC1 domain containing 1
RefSeq NM_001017919.1
Length of RefSeq (bp) 2690
Chromosome 15q26.1
Reference DDBJ accession
UniGene Hs.655895

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd41H06 pGCAP10 GGGGTTTTGAGCTGCCGCGGTCCCGGGACTGAGCTCCTTGGGAGCAGACAGCTGTCCTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl