Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07875

HP ID(1) HP07875
Gene ID(2) 9334
Gene Symbol finder B4GALT5
Protein Name UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
RefSeq NM_004776.3
Length of RefSeq (bp) 4743
Chromosome 20q13.1-q13.2
Reference DDBJ accession
UniGene Hs.370487

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd41D10 pGCAP10 GGAGCGGCGAGGCGGCGGCGGCGGCGAGTGGCGGCCCGCGAGGCCCGGGAGGCGGTGGCC
RBd59H09 pGCAP10 GGCCGCTCTGGCCCCCGCCCGCTTCATGTGGCCCGGCCCGCGACGGCCGGCGGCTGGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl