Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - B4GALT5

Gene ID (NCBI) 9334
Gene Symbol B4GALT5
Protein Name beta-1,4-galactosyltransferase 5
Synonyms B4Gal-T5|BETA4-GALT-IV|beta4Gal-T5|beta4GalT-V|gt-V
Databases KEGG hsa:9334 |  NCBI Gene 9334
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09905)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR376482 RBd41D10 pGCAP10 NM_004776.3  
GGAGCGGCGAGGCGGCGGCGGCGGCGAGTGGCGGCCCGCGAGGCCCGGGAGGCGGTGGCC
HKR383777 RBd59H09 pGCAP10 NM_004776.3  
GGCCGCTCTGGCCCCCGCCCGCTTCATGTGGCCCGGCCCGCGACGGCCGGCGGCTGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl