Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07859

HP ID(1) HP07859
Gene ID(2) 56942
Gene Symbol finder C16orf61
Protein Name chromosome 16 open reading frame 61
RefSeq NM_020188.2
Length of RefSeq (bp) 818
Chromosome 16q23.2
Reference DDBJ accession
UniGene Hs.388255

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd39H03 pGCAP10 GCGGGAGCACGGTGGAGCGGTGGAGGGCGTCACTGGGTTTCGGCGTCTGGCAAGCGGTTC
RBd81D12 pGCAP10 GGAGCCGGGAGCACGGTGGAGCGGTGGAGGGCGTCACTGGGTTTCGGCGTCTGGCAAGCG
RBdS013L03 pGCAP10 GGGTGGAGGGCGTCACTGGGTTTCGGCGTCTGGCAAGCGGTTCAGCTGTCTGCTCCCTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl