Prev. |  KEGG KO K18172 > 

RIKEN DNA Bank Human Resource - CMC2

Gene ID NCBI Gene 56942 |  KEGG hsa:56942
Gene Symbol CMC2
Protein Name C-X9-C motif containing 2
Synonyms 2310061C15Rik|C16orf61|DC13
Ortholog resources KEGG ortholog (KEGG orthology K18172) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027681 IRAK069D09 pCMV-SPORT6 BC032631 NM_020188

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094014 M01C035A14 pDONR221 MGC07-B07 BC032631 NM_020188  
HGE094062 M01C035C14 pDONR221 MGC07-B07 BC032631 NM_020188  
HGE094110 M01C035E14 pDONR221 MGC07-B07 BC032631 NM_020188  
HGE094158 M01C035G14 pDONR221 MGC07-B07 BC032631 NM_020188  
HGE094206 M01C035I14 pDONR221 MGC07-B07 BC032631 NM_020188  
HGE094254 M01C035K14 pDONR221 MGC07-B07 BC032631 NM_020188  
HGE094302 M01C035M14 pDONR221 MGC07-B07 BC032631 NM_020188  
HGE094350 M01C035O14 pDONR221 MGC07-B07 BC032631 NM_020188  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR375771 RBd39H03 pGCAP10 NM_020188.2  
GCGGGAGCACGGTGGAGCGGTGGAGGGCGTCACTGGGTTTCGGCGTCTGGCAAGCGGTTC
HKR392484 RBd81D12 pGCAP10 NM_020188.2  
GGAGCCGGGAGCACGGTGGAGCGGTGGAGGGCGTCACTGGGTTTCGGCGTCTGGCAAGCG
HKR405467 RBdS013L03 pGCAP10 NM_020188.2  
GGGTGGAGGGCGTCACTGGGTTTCGGCGTCTGGCAAGCGGTTCAGCTGTCTGCTCCCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl