Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07850

HP ID(1) HP07850
Gene ID(2) 5822
Gene Symbol finder PWP2
Protein Name PWP2 periodic tryptophan protein homolog (yeast)
RefSeq NM_005049.2
Length of RefSeq (bp) 3277
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.449076

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd39B04 pGCAP10 GGCGGACCCCCGGGAAGTGTCTCTGTGGGCGGCCGCCGGGTTGAGCTGCGGCACACGTGC
RBd44H02 pGCAP10 GACACGTGCGACGGCCGTGATGAAGTTCGCTTACCGGTTTTCAAATTTGCTGGGTACGGT
RBdS105F05 pGCAP10 GGCGCGGACCCCCGGGAAGTGTCTCTGTGGGCGGCCGCCGGGTTGAGCTGCGGCACACGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl