Prev. |  KEGG KO K14558 > 

RIKEN DNA Bank Human Resource - PWP2

Gene ID NCBI Gene 5822 |  KEGG hsa:5822
Gene Symbol PWP2
Protein Name PWP2, small subunit processome component
Synonyms EHOC-17|PWP2H|UTP1
Ortholog resources KEGG ortholog (KEGG orthology K14558) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084747 IRAL011O11 pOTB7 BC013309 NM_005049 Full/var
HGY093960 IRAL034O24 pOTB7 BC014988 NM_005049 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR375628 RBd39B04 pGCAP10 NM_005049.2  
GGCGGACCCCCGGGAAGTGTCTCTGTGGGCGGCCGCCGGGTTGAGCTGCGGCACACGTGC
HKR377770 RBd44H02 pGCAP10 NM_005049.2  
GACACGTGCGACGGCCGTGATGAAGTTCGCTTACCGGTTTTCAAATTTGCTGGGTACGGT
HKR442125 RBdS105F05 pGCAP10 NM_005049.2  
GGCGCGGACCCCCGGGAAGTGTCTCTGTGGGCGGCCGCCGGGTTGAGCTGCGGCACACGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl