Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07845

HP ID(1) HP07845
Gene ID(2) 50640
Gene Symbol finder PNPLA8
Protein Name patatin-like phospholipase domain containing 8
RefSeq NM_015723.2
Length of RefSeq (bp) 3548
Chromosome 7q31
Reference DDBJ accession
UniGene Hs.617340

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd38F04 pGCAP10 GAGGGGCTCGAGAGGCCTGGACCTGTGGCGCATCCTCAGTGAGGAGGGCCGCCCTGCATC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl