Prev. |  KEGG KO K16815 > 

RIKEN DNA Bank Human Resource - PNPLA8

Gene ID NCBI Gene 50640 |  KEGG hsa:50640
Gene Symbol PNPLA8
Protein Name patatin like phospholipase domain containing 8
Synonyms IPLA2-2|IPLA2G|MMLA|PNPLA-gamma|iPLA2gamma
Ortholog resource in our bank

  PNPLA8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013749 IRAK034G05 pBluescriptR BC032999 NM_015723

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089609 M01C024A09 pDONR221 MGC01-E05 BC032999 NM_015723  
HGE089657 M01C024C09 pDONR221 MGC01-E05 BC032999 NM_015723  
HGE089705 M01C024E09 pDONR221 MGC01-E05 BC032999 NM_015723  
HGE089753 M01C024G09 pDONR221 MGC01-E05 BC032999 NM_015723  
HGE089801 M01C024I09 pDONR221 MGC01-E05 BC032999 NM_015723  
HGE089849 M01C024K09 pDONR221 MGC01-E05 BC032999 NM_015723  
HGE089897 M01C024M09 pDONR221 MGC01-E05 BC032999 NM_015723  
HGE089945 M01C024O09 pDONR221 MGC01-E05 BC032999 NM_015723  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR375324 RBd38F04 pGCAP10 NM_015723.2  
GAGGGGCTCGAGAGGCCTGGACCTGTGGCGCATCCTCAGTGAGGAGGGCCGCCCTGCATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl