Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07841

HP ID(1) HP07841
Gene ID(2) 7013
Gene Symbol finder TERF1
Protein Name telomeric repeat binding factor (NIMA-interacting) 1
RefSeq NM_003218.3
Length of RefSeq (bp) 2900
Chromosome 8q13
Reference DDBJ accession
UniGene Hs.442707

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd38B06 pGCAP10 GGCGGCCACGCCCCGAGCCCTCGAATGCGAGCCAATCGTTGCTCGGCGCCTGAAGGGGCA
RBdS070K06 pGCAP10 GGCCCGAGCCCGCGGGGCTGTGCGGATGGTAGGGATGCCGACCCTACTGAGGAGCAGATG
RBdS105N17 pGCAP10 TTGATTTTAACATGGCGGAGGATGTTTCCTCAGCGGCCCCGAGCCCGCGGGGCTGTGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl