DNA Bank Top |  KEGG KO K11110 > 

RIKEN DNA Bank Human Resource - TERF1

Gene ID NCBI Gene 7013 |  KEGG hsa:7013
Gene Symbol TERF1
Protein Name telomeric repeat binding factor 1
Synonyms PIN2|TRBF1|TRF|TRF1|hTRF1-AS|t-TRF1

Link

Ortholog resource in our bank

  TERF1

External database

human TERF1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB06713 pET_hsTRF1 Prokaryotic expression vector of human TERF1    
RDB03871 SEREX clone NGO-St-123 (ID 1335) #1 SEREX clone NGO-St-123 (ID 1335) #1    
RDB03795 SEREX clone NGO-St-002 (ID 9) #2 SEREX clone NGO-St-002 (ID 9) #2    
RDB03794 SEREX clone NGO-St-002 (ID 9) #1 SEREX clone NGO-St-002 (ID 9) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096693 IRAL041M05 pDNR-LIB BC029378 NM_003218 Full/var
HGY103294 IRAL058D22 pOTB7 BC071975 NM_003218 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038140 W01A095F20 pENTR-TOPO IRAL041M05 BC029378 NM_003218  
HGE038144 W01A095F24 pENTR-TOPO IRAL041M05 BC029378 NM_003218  
HGE038190 W01A095H22 pENTR-TOPO IRAL041M05 BC029378 NM_003218  
HGE038218 W01A095J02 pENTR-TOPO IRAL041M05 BC029378 NM_003218  
HGE038222 W01A095J06 pENTR-TOPO IRAL041M05 BC029378 NM_003218  
HGE038226 W01A095J10 pENTR-TOPO IRAL041M05 BC029378 NM_003218  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR375230 RBd38B06 pGCAP10 NM_003218.3  
GGCGGCCACGCCCCGAGCCCTCGAATGCGAGCCAATCGTTGCTCGGCGCCTGAAGGGGCA
HKR428246 RBdS070K06 pGCAP10 NM_003218.3  
GGCCCGAGCCCGCGGGGCTGTGCGGATGGTAGGGATGCCGACCCTACTGAGGAGCAGATG
HKR442329 RBdS105N17 pGCAP10 NM_003218.3  
TTGATTTTAACATGGCGGAGGATGTTTCCTCAGCGGCCCCGAGCCCGCGGGGCTGTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl