Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07836

HP ID(1) HP07836
Gene ID(2) 29781
Gene Symbol finder NCAPH2
Protein Name non-SMC condensin II complex, subunit H2
RefSeq NM_014551.4
Length of RefSeq (bp) 1440
Chromosome 22q13.33
Reference DDBJ accession
UniGene Hs.180903

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd37F02 pGCAP10 GGCCAGAACTAGTGGCGGGCTGAGGACGCCGTACCCCTCGGAAGGCAGCCCTGCGGTCCC
RBd72A11 pGCAP10 GAAAAATGGCGCCAGAACTAGTGGCGGGCTGAGGACGCCGTACCCCTCGGAAGGCAGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl