Prev. |  KEGG KO K11490 > 

RIKEN DNA Bank Human Resource - NCAPH2

Gene ID NCBI Gene 29781 |  KEGG hsa:29781
Gene Symbol NCAPH2
Protein Name non-SMC condensin II complex subunit H2
Synonyms CAPH2
Ortholog resource in our bank

  NCAPH2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001710 IRAK004E14 pCMV-SPORT6 BC001298 NM_152299 Full/var
HGX006353 IRAK015O17 pCMV-SPORT6 BC014939 NM_152299 Partial
HGY083947 IRAL009O11 pOTB7 BC001937 NM_152299
HGY089327 IRAL023F07 pOTB7 BC009441 NM_152299 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097645 M01C044B21 pDONR221 MGC11-G11 BC001937 NM_152299  
HGE097693 M01C044D21 pDONR221 MGC11-G11 BC001937 NM_152299  
HGE097741 M01C044F21 pDONR221 MGC11-G11 BC001937 NM_152299  
HGE097789 M01C044H21 pDONR221 MGC11-G11 BC001937 NM_152299  
HGE097837 M01C044J21 pDONR221 MGC11-G11 BC001937 NM_152299  
HGE097885 M01C044L21 pDONR221 MGC11-G11 BC001937 NM_152299  
HGE097933 M01C044N21 pDONR221 MGC11-G11 BC001937 NM_152299 done
HGE097981 M01C044P21 pDONR221 MGC11-G11 BC001937 NM_152299  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374922 RBd37F02 pGCAP10 NM_014551.4  
GGCCAGAACTAGTGGCGGGCTGAGGACGCCGTACCCCTCGGAAGGCAGCCCTGCGGTCCC
HKR388811 RBd72A11 pGCAP10 NM_014551.4  
GAAAAATGGCGCCAGAACTAGTGGCGGGCTGAGGACGCCGTACCCCTCGGAAGGCAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl