Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07812

HP ID(1) HP07812
Gene ID(2) 5586
Gene Symbol finder PKN2
Protein Name protein kinase N2
RefSeq NM_006256.2
Length of RefSeq (bp) 6104
Chromosome 1p22.2
Reference DDBJ accession
UniGene Hs.440833

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd35B09 pGCAP10 GCGCGGCCGCAGCGCCCGCACGGAGAGGCTTGAGGCGGCTCCTGGCGTCGCCCAGAGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl