Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PKN2

Gene ID (NCBI) 5586
Gene Symbol PKN2
Protein Name protein kinase N2
Synonyms PAK2|PRK2|PRKCL2|PRO2042|Pak-2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR374033 RBd35B09 pGCAP10 NM_006256.2  
GCGCGGCCGCAGCGCCCGCACGGAGAGGCTTGAGGCGGCTCCTGGCGTCGCCCAGAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl