Prev. |  KEGG KO K06071 > 

RIKEN DNA Bank Human Resource - PKN2

Gene ID NCBI Gene 5586 |  KEGG hsa:5586
Gene Symbol PKN2
Protein Name protein kinase N2
Synonyms PAK2|PRK2|PRKCL2|PRO2042|Pak-2|STK7
Ortholog resources KEGG ortholog (KEGG orthology K06071) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR374033 RBd35B09 pGCAP10 NM_006256.2  
GCGCGGCCGCAGCGCCCGCACGGAGAGGCTTGAGGCGGCTCCTGGCGTCGCCCAGAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl