Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07809

HP ID(1) HP07809
Gene ID(2) 79036
Gene Symbol finder C19orf50
Protein Name chromosome 19 open reading frame 50
RefSeq NM_024069.2
Length of RefSeq (bp) 1435
Chromosome 19p13.11
Reference DDBJ accession
UniGene Hs.369785

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd34H09 pGCAP10 GGCGGGCGCCATCCCGGAAGCGCGAGCAAGGCCGCCAGATGTGCAGGCAGCGGAGGAGGA
RBd99D09 pGCAP10 CGGCCGGCCGATTTGGACTTAACGCACGCAAGCGGCTCCAGGGTACGTCCCCGCCACGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl