Prev. |  KEGG KO K20818 > 

RIKEN DNA Bank Human Resource - KXD1

Gene ID NCBI Gene 79036 |  KEGG hsa:79036
Gene Symbol KXD1
Protein Name KxDL motif containing 1
Synonyms BORCS4|C10orf50|C19orf50|KXDL|MST096|MSTP096
Ortholog resources KEGG ortholog (KEGG orthology K20818) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081173 IRAL002P13 pOTB7 BC001080 NM_024069
HGY083942 IRAL009O06 pOTB7 BC006479 NM_024069 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR373777 RBd34H09 pGCAP10 NM_024069.2  
GGCGGGCGCCATCCCGGAAGCGCGAGCAAGGCCGCCAGATGTGCAGGCAGCGGAGGAGGA
HKR399681 RBd99D09 pGCAP10 NM_024069.2  
CGGCCGGCCGATTTGGACTTAACGCACGCAAGCGGCTCCAGGGTACGTCCCCGCCACGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl