Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07806

HP ID(1) HP07806
Gene ID(2) 22838
Gene Symbol finder RNF44
Protein Name ring finger protein 44
RefSeq NM_014901.4
Length of RefSeq (bp) 4153
Chromosome 5q35.2
Reference DDBJ accession
UniGene Hs.434888

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd34F12 pGCAP10 GGAAGGTGGCCGGCCCAGGGTTGTTAGAGCCAGCATAACCACTTGGGCCGCTCTCGCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl