Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07802

HP ID(1) HP07802
Gene ID(2) 340719
Gene Symbol finder NANOS1
Protein Name nanos homolog 1 (Drosophila)
RefSeq NM_199461.2
Length of RefSeq (bp) 4627
Chromosome 10q26.11
Reference DDBJ accession
UniGene Hs.591918

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd34B04 pGCAP10 GGCAGGCCGGCGGGCAGGCTCGGCGTGTCCCTTCCCTCCGGCCCGCGCCGGCGGCGGGGA
RBd79E04 pGCAP10 GGCGGCANNCCGGCGGGCAGGCTCGGCGTGTCCCTTCCGTCCGGCCCGCGCCGGCGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl