Prev. |  KEGG KO K18741 > 

RIKEN DNA Bank Human Resource - NANOS1

Gene ID NCBI Gene 340719 |  KEGG hsa:340719
Gene Symbol NANOS1
Protein Name nanos C2HC-type zinc finger 1
Synonyms EC_Rep1a|NOS-1|NOS1|SPGF12|ZC2HC12A
Ortholog resource in our bank

  NANOS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR373628 RBd34B04 pGCAP10 NM_199461.2  
GGCAGGCCGGCGGGCAGGCTCGGCGTGTCCCTTCCCTCCGGCCCGCGCCGGCGGCGGGGA
HKR391700 RBd79E04 pGCAP10 NM_199461.2  
GGCGGCANNCCGGCGGGCAGGCTCGGCGTGTCCCTTCCGTCCGGCCCGCGCCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl