Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07800

HP ID(1) HP07800
Gene ID(2) 55161
Gene Symbol finder TMEM33
Protein Name transmembrane protein 33
RefSeq NM_018126.1
Length of RefSeq (bp) 2684
Chromosome 4p13
Reference DDBJ accession
UniGene Hs.31082

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd34A03 pGCAP10 GACCTTCGCTCCCGTCTTTCTGGAAACACCGCTTTGATCTCGGCGGTGCGGGACAGGTAC
RBdS015B17 pGCAP10 GCTCTTTANGGCTTCACCCCGAAGCTCCACCTTCGCTCCCGTCTTTCTGGAAACACCGCT
RBdS187N24 pGCAP10 GAGCTCCACCTTCGCTCCCGTCTTTCTGGAAACACCGCTTTGATCTCGGCGGTGCGGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl